Methylation on the SFRP2 promoter in breast cancer cell lin

View previous topic View next topic Go down

Methylation on the SFRP2 promoter in breast cancer cell lin

Post  jy9202 on Mon Mar 23, 2015 8:10 am

11. Methylation Status by Methylation [You must be registered and logged in to see this link.] Specific PCR DNA methylation patterns in CpG islands of tumor sup pressor genes FHIT, FNACF and BRCA2 have been determined by chemical modification with sodium bisulphite as described previously. Briefly, 1g DNA l was dena tured by NaOH for ten min at 37 C. 1g of salmon sperm DNA was added as carrier ahead of modification. Freshly prepared 30l of hydroquinone and 520l of sodium bisulfite have been mixed and samples have been incubated underneath mineral oil at 55 C for sixteen hr. The DNA samples were desalted by way of Wizard col umns, desulfonated by NaOH for 5 min at room tempera ture, followed by ethanol precipitation. DNA was resus pended in water and made use of quickly or stored at 20 C. 50l of bisulphite modified DNA was applied for each MSP.

Following primer pairs for FHIT gene, methylated CpG web-site Each and every PCR response created 74 bp solutions both with methylated and unmethylated prim ers for FHIT, 153 bp for FANCF each [You must be registered and logged in to see this link.] with methylated and unmethylated primers, 337 and 250 bp solution with BRCA2 primers particular for methylated and unmethylated primers and 276 and 222 bp solution for cyclin D2 primers certain for methylated and unmethylated PCR reactions respectively. For the PCR response of 25l, 50 ng sodium bisulfite treated DNA was added to response buffer con taining 0. 2 mM dNTP, 16. six mM 2SO4, 67 mM Tris pH 8. 8, 10 mM mercaptoethanol, 1. 5 mM MgCl2, 10 pmol of forward and reverse primers certain to the meth ylated and methylated DNA sequences and 1. 25 units of AmpliTaq Gold.

The PCR reactions had been cycled [You must be registered and logged in to see this link.] inside a GeneAmp 9600 ther mal cycler beneath the following con ditions preheat at 94 C for three min. followed by 40 cycles for unmethylated DNA of RUNX3 with annealing temperature of fifty five C for 20 seconds. For each PCR set, DNA isolated from ordinary peripheral lym phocytes of balanced people served like a negative meth ylation manage. Human placental DNA was handled in vitro with SssI methyltransferase to make wholly methylated DNA in any respect CpG rich areas and served as favourable methylation handle. Methylation distinct PCR items have been analysed on 3% agarose gel electrophoresis with ethidium bromide staining. A posi tive handle in addition to a damaging control were integrated in each and every amplification response.

FHIT, FANCF, Cyclin D2 and RUNX3 Expression by RT PCR FHIT, FNACF and cyclin D2 mRNA levels in cancer sufferers were when compared with their expression in ordinary cells working with semi quantitative reverse transcriptase polymerase chain response. In quick, cDNA was synthesized applying AMV reverse transcriptase and amplified in duplex reactions within a complete volume of 25l containing 150M of every dNTP, one. 5 mM MgCl2, ten pmol of every primer pair and 1. 0 units of Taq polymerase. Right after original denaturation. The values in the brackets correspond to FANCF. The next primers were made use of to amplify FHIT forward five gctcttgtgaataggaaacc 3 and reverse five tcactggttgaagaata cagg three which yields 532 bp product spanning inside of exon 5 to exon ten, FANCF forward 5 ttcggaagtctttgctgcct three and reverse five agtaataacacacgattgcc three which yields 413 bp merchandise spanning from 733 to 1144.

jy9202

Posts : 509
Join date : 2013-12-18

View user profile

Back to top Go down

View previous topic View next topic Back to top

- Similar topics

 
Permissions in this forum:
You cannot reply to topics in this forum